![download jedit for windows download jedit for windows](https://windows-cdn.softpedia.com/screenshots/PHPParser-for-jEdit_1.png)
Rich text / MS Word / Word Perfect / etc.
![download jedit for windows download jedit for windows](https://1.bp.blogspot.com/-0QAqY5jJ7IQ/XsvTkUgUcOI/AAAAAAAAAsA/_RrejWD-LM4Rbxd6mRqoCF0lMpFcV1AZQCK4BGAsYHg/1.png)
There are two main concerns when speaking about text files: How difficult can it be? Text is text, right? That way will be easy to use the data as input for different kinds of programs, and write simple scripts (small programs) that reads some kind of input, performs some sort of analysis and outputs the result in a readable manner. The main idea is to keep everything simple and open. The same approach is usually also used for other kinds or data - lists of gene names, statistics on DNA patterns etc. GCACCATGGCTCCGACCAGGTCCGCAACCACGGCAAGAAGGTGTTGGCCGCCTTGGGCAACGCTGTCAAGĪGCCTGGGCAACCTCAGCCAAGCCCTGTCTGACCTCAGCGACCTGCATGCCTACAACCTGCGTGTCGACCĬTGTCAACTTCAAGCTGCTGGCGCAGTGCTTCCACGTGGTGCTGGCCACACACCTGGGCAACGACTACACĬCCGGAGGCACATGCTGCCTTCGACAAGTTCCTGTCGGCTGTGTGCACCGTGCTGGCCGAGAAGTACAGA GAGCCGAGGCCCTGGAGAGGCTGTTCACCACCTACCCCCAGACCAAGACCTACTTCCCCCACTTCGACTT For example:ĪTGCTGACCGACTCTGACAAGAAGCTGGTCCTGCAGGTGTGGGAGAAGGTGATCCGCCACCCAGACTGTG In bioinformatics it's very common to have the data hosted in simple plain text format. 4.2 Search and Replace & Block selection.4.1 On file extensions and default programs.2.2 Different interpretations of "plain text".2 How difficult can it be? Text is text, right?.1 Background: data in plain text format.